rna oligonucleotides Search Results


93
Vazyme Biotech Co n323 vahts rna multiplex oligos set 1 for lllumina
N323 Vahts Rna Multiplex Oligos Set 1 For Lllumina, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+oligonucleotides/VAHTS+RNA+Multiplex+Oligos+Set+1+Set+2+for+Illumina/pmc09935910-178-40-49
Average 93 stars, based on 1 article reviews
n323 vahts rna multiplex oligos set 1 for lllumina - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

94
Integrated DNA Technologies ultramer rna oligo
Ultramer Rna Oligo, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+oligonucleotides/Ultramer+RNA+Oligos/pmc07721139-101-14-17
Average 94 stars, based on 1 article reviews
ultramer rna oligo - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

95
New England Biolabs nebnext primer mix
Nebnext Primer Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+oligonucleotides/NEBNext+Multiplex+Oligos+for+Illumina+(Unique+Dual+Index+UMI+Adaptors+RNA+Set+1)%7C/bio_rxiv__2023__10__04__560902-210-25-36
Average 95 stars, based on 1 article reviews
nebnext primer mix - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

90
Shanghai GenePharma rna oligonucleotides 5′-cggugugcaccaacaucuatt-3′ (sense)
Rna Oligonucleotides 5′ Cggugugcaccaacaucuatt 3′ (Sense), supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+oligonucleotides/rna+oligonucleotides+5++cggugugcaccaacaucuatt+3+++sense+/pmc04160217-42-1-11
Average 90 stars, based on 1 article reviews
rna oligonucleotides 5′-cggugugcaccaacaucuatt-3′ (sense) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
GenScript corporation rna oligonucleotide
Rna Oligonucleotide, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+oligonucleotides/rna+oligonucleotides/pm27255754-89-1-7
Average 90 stars, based on 1 article reviews
rna oligonucleotide - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Ribobio co mir-147 mimic
Mir 147 Mimic, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+oligonucleotides/chemically+modified+antisense+rna+oligonucleotide+against+mir+147a/pmc04727187-162-0-14
Average 90 stars, based on 1 article reviews
mir-147 mimic - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Purigo Biotech Inc the rna oligonucleotides were synthesized and biotin-labeled at their 3′ ends
The Rna Oligonucleotides Were Synthesized And Biotin Labeled At Their 3′ Ends, supplied by Purigo Biotech Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+oligonucleotides/the+rna+oligonucleotides+were+synthesized+and+biotin+labeled+at+their+3++ends/pmc06945828-520-9-11
Average 90 stars, based on 1 article reviews
the rna oligonucleotides were synthesized and biotin-labeled at their 3′ ends - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Biospring rna oligonucleotides
Rna Oligonucleotides, supplied by Biospring, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+oligonucleotides/rna+oligonucleotides/pm25183497-231-0-5
Average 90 stars, based on 1 article reviews
rna oligonucleotides - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
CRUACHEM LIMITED synthetic rna oligonucleotide (5′v16b
Immobilised affinity purified polymerase is transcriptionally active. Nuclear extracts from Vac3P or VacT7 infected HeLa cells were mixed with SA-beads coated with the <t>5′-v16B</t> oligonucleotide. The SA-beads were then resuspended in transcription buffer containing nucleotides, the indicated primer and 3′-vRNA template. Transcription products incorporated [α- 32P]GTP and were resolved on an 18% 7 M urea denaturing polyacrylamide gel and visualised by autoradiography for (A) 16 or (B) 120 h. (A) Lane 1: ApG primed reaction. Lane 2, globin mRNA primed reaction. Lane 3, ApG primed reaction with the omission of the 5′-v16B oligonucleotide. Lane 4, ApG primed reaction with the omission of 3′V template RNA. Lane 5, unprimed reaction. Lane 6, globin mRNA primed reaction using VacT7 nuclear extract. Lane 7, ApG primed reaction using VacT7 extract. (B) Co-expression of PB2 is required for unprimed, ApG primed, globin mRNA primed transcription. Lanes 1–3, SA beads coated with Vac3P. Lanes 4–6, SA beads coated with VacPB1/PA. Lane 7, SA beads coated with VacT7. Lane 8, Vac3P extract plus 5′-v16B (omitting bead selection procedure). Lanes 1 and 4, unprimed transcription. Lanes 2, 5, 7 and 8, ApG primed transcription. Lanes 3 and 6, globin mRNA primed. Lane 4, VacPB1/PA, unprimed synthesis.
Synthetic Rna Oligonucleotide (5′V16b, supplied by CRUACHEM LIMITED, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+oligonucleotides/synthetic+rna+oligonucleotide++5+v16b/pmc00099831-61-1-7
Average 90 stars, based on 1 article reviews
synthetic rna oligonucleotide (5′v16b - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
CureVac Inc 5 -biotinylated rna
Immobilised affinity purified polymerase is transcriptionally active. Nuclear extracts from Vac3P or VacT7 infected HeLa cells were mixed with SA-beads coated with the <t>5′-v16B</t> oligonucleotide. The SA-beads were then resuspended in transcription buffer containing nucleotides, the indicated primer and 3′-vRNA template. Transcription products incorporated [α- 32P]GTP and were resolved on an 18% 7 M urea denaturing polyacrylamide gel and visualised by autoradiography for (A) 16 or (B) 120 h. (A) Lane 1: ApG primed reaction. Lane 2, globin mRNA primed reaction. Lane 3, ApG primed reaction with the omission of the 5′-v16B oligonucleotide. Lane 4, ApG primed reaction with the omission of 3′V template RNA. Lane 5, unprimed reaction. Lane 6, globin mRNA primed reaction using VacT7 nuclear extract. Lane 7, ApG primed reaction using VacT7 extract. (B) Co-expression of PB2 is required for unprimed, ApG primed, globin mRNA primed transcription. Lanes 1–3, SA beads coated with Vac3P. Lanes 4–6, SA beads coated with VacPB1/PA. Lane 7, SA beads coated with VacT7. Lane 8, Vac3P extract plus 5′-v16B (omitting bead selection procedure). Lanes 1 and 4, unprimed transcription. Lanes 2, 5, 7 and 8, ApG primed transcription. Lanes 3 and 6, globin mRNA primed. Lane 4, VacPB1/PA, unprimed synthesis.
5 Biotinylated Rna, supplied by CureVac Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+oligonucleotides/rna+3++biotinylated+gagagagagaga+ribo+oligonucleotides/10__1128_slash_mcb__01145___08-78-26-36
Average 90 stars, based on 1 article reviews
5 -biotinylated rna - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
TriLink biotinylated target dna oligonucleotide 5'/tgctggtttccgttgtttgt/biotinbb-/3
Immobilised affinity purified polymerase is transcriptionally active. Nuclear extracts from Vac3P or VacT7 infected HeLa cells were mixed with SA-beads coated with the <t>5′-v16B</t> oligonucleotide. The SA-beads were then resuspended in transcription buffer containing nucleotides, the indicated primer and 3′-vRNA template. Transcription products incorporated [α- 32P]GTP and were resolved on an 18% 7 M urea denaturing polyacrylamide gel and visualised by autoradiography for (A) 16 or (B) 120 h. (A) Lane 1: ApG primed reaction. Lane 2, globin mRNA primed reaction. Lane 3, ApG primed reaction with the omission of the 5′-v16B oligonucleotide. Lane 4, ApG primed reaction with the omission of 3′V template RNA. Lane 5, unprimed reaction. Lane 6, globin mRNA primed reaction using VacT7 nuclear extract. Lane 7, ApG primed reaction using VacT7 extract. (B) Co-expression of PB2 is required for unprimed, ApG primed, globin mRNA primed transcription. Lanes 1–3, SA beads coated with Vac3P. Lanes 4–6, SA beads coated with VacPB1/PA. Lane 7, SA beads coated with VacT7. Lane 8, Vac3P extract plus 5′-v16B (omitting bead selection procedure). Lanes 1 and 4, unprimed transcription. Lanes 2, 5, 7 and 8, ApG primed transcription. Lanes 3 and 6, globin mRNA primed. Lane 4, VacPB1/PA, unprimed synthesis.
Biotinylated Target Dna Oligonucleotide 5'/Tgctggtttccgttgtttgt/Biotinbb /3, supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+oligonucleotides/biotin+conjugated+rna+oligonucleotides/pmc04104391-140-0-11
Average 90 stars, based on 1 article reviews
biotinylated target dna oligonucleotide 5'/tgctggtttccgttgtttgt/biotinbb-/3 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Ribobio co rna oligonucleotides
Immobilised affinity purified polymerase is transcriptionally active. Nuclear extracts from Vac3P or VacT7 infected HeLa cells were mixed with SA-beads coated with the <t>5′-v16B</t> oligonucleotide. The SA-beads were then resuspended in transcription buffer containing nucleotides, the indicated primer and 3′-vRNA template. Transcription products incorporated [α- 32P]GTP and were resolved on an 18% 7 M urea denaturing polyacrylamide gel and visualised by autoradiography for (A) 16 or (B) 120 h. (A) Lane 1: ApG primed reaction. Lane 2, globin mRNA primed reaction. Lane 3, ApG primed reaction with the omission of the 5′-v16B oligonucleotide. Lane 4, ApG primed reaction with the omission of 3′V template RNA. Lane 5, unprimed reaction. Lane 6, globin mRNA primed reaction using VacT7 nuclear extract. Lane 7, ApG primed reaction using VacT7 extract. (B) Co-expression of PB2 is required for unprimed, ApG primed, globin mRNA primed transcription. Lanes 1–3, SA beads coated with Vac3P. Lanes 4–6, SA beads coated with VacPB1/PA. Lane 7, SA beads coated with VacT7. Lane 8, Vac3P extract plus 5′-v16B (omitting bead selection procedure). Lanes 1 and 4, unprimed transcription. Lanes 2, 5, 7 and 8, ApG primed transcription. Lanes 3 and 6, globin mRNA primed. Lane 4, VacPB1/PA, unprimed synthesis.
Rna Oligonucleotides, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+oligonucleotides/rna+oligonucleotides/10__2147_slash_cmar__s232380-57-0-5
Average 90 stars, based on 1 article reviews
rna oligonucleotides - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Immobilised affinity purified polymerase is transcriptionally active. Nuclear extracts from Vac3P or VacT7 infected HeLa cells were mixed with SA-beads coated with the 5′-v16B oligonucleotide. The SA-beads were then resuspended in transcription buffer containing nucleotides, the indicated primer and 3′-vRNA template. Transcription products incorporated [α- 32P]GTP and were resolved on an 18% 7 M urea denaturing polyacrylamide gel and visualised by autoradiography for (A) 16 or (B) 120 h. (A) Lane 1: ApG primed reaction. Lane 2, globin mRNA primed reaction. Lane 3, ApG primed reaction with the omission of the 5′-v16B oligonucleotide. Lane 4, ApG primed reaction with the omission of 3′V template RNA. Lane 5, unprimed reaction. Lane 6, globin mRNA primed reaction using VacT7 nuclear extract. Lane 7, ApG primed reaction using VacT7 extract. (B) Co-expression of PB2 is required for unprimed, ApG primed, globin mRNA primed transcription. Lanes 1–3, SA beads coated with Vac3P. Lanes 4–6, SA beads coated with VacPB1/PA. Lane 7, SA beads coated with VacT7. Lane 8, Vac3P extract plus 5′-v16B (omitting bead selection procedure). Lanes 1 and 4, unprimed transcription. Lanes 2, 5, 7 and 8, ApG primed transcription. Lanes 3 and 6, globin mRNA primed. Lane 4, VacPB1/PA, unprimed synthesis.

Journal:

Article Title: Definition of the minimal viral components required for the initiation of unprimed RNA synthesis by influenza virus RNA polymerase

doi:

Figure Lengend Snippet: Immobilised affinity purified polymerase is transcriptionally active. Nuclear extracts from Vac3P or VacT7 infected HeLa cells were mixed with SA-beads coated with the 5′-v16B oligonucleotide. The SA-beads were then resuspended in transcription buffer containing nucleotides, the indicated primer and 3′-vRNA template. Transcription products incorporated [α- 32P]GTP and were resolved on an 18% 7 M urea denaturing polyacrylamide gel and visualised by autoradiography for (A) 16 or (B) 120 h. (A) Lane 1: ApG primed reaction. Lane 2, globin mRNA primed reaction. Lane 3, ApG primed reaction with the omission of the 5′-v16B oligonucleotide. Lane 4, ApG primed reaction with the omission of 3′V template RNA. Lane 5, unprimed reaction. Lane 6, globin mRNA primed reaction using VacT7 nuclear extract. Lane 7, ApG primed reaction using VacT7 extract. (B) Co-expression of PB2 is required for unprimed, ApG primed, globin mRNA primed transcription. Lanes 1–3, SA beads coated with Vac3P. Lanes 4–6, SA beads coated with VacPB1/PA. Lane 7, SA beads coated with VacT7. Lane 8, Vac3P extract plus 5′-v16B (omitting bead selection procedure). Lanes 1 and 4, unprimed transcription. Lanes 2, 5, 7 and 8, ApG primed transcription. Lanes 3 and 6, globin mRNA primed. Lane 4, VacPB1/PA, unprimed synthesis.

Article Snippet: A synthetic RNA oligonucleotide (5′V16B) was synthesised (Cruachem Ltd) with the sequence: 5′-AGUAGAAACAAGGGUG(CH 2 ) 12 -biotin.

Techniques: Affinity Purification, Infection, Autoradiography, Expressing, Selection